2nd PUC Biology Chapter 6 Question Bank

2nd PUC Biology Question and Answer: Molecular Basis Of Inheritance

Looking for 2nd PUC Biology textbook answers? You can download Chapter 6: Molecular Basis Of Inheritance Questions and Answers PDF, Notes, and Summary here. 2nd PUC Biology solutions follow the Karnataka State Board Syllabus, making it easier for students to revise and score higher in exams.

Karnataka 2nd PUC Biology Textbook Answers—Reflections Chapter 6

Molecular Basis Of Inheritance Questions and Answers, Notes, and Summary

2nd PUC Biology Chapter 6

Molecular Basis Of Inheritance

Scroll Down to Downlaod Molecular Basis Of Inheritance PDF 
Question and Answer:

Question 1
Group the following as nitrogenous bases and nucleosides:
Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Answer :

  • Nitrogenous bases: Adenine, Cytosine, Thymine, Uracil
  • Nucleosides: Guanosine, Cytidine

Question 2.
If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Answer:
By Chargaff’s Rule:

Cytosine (C) = 20%
∴ Guanine (G) = 20%

 

2nd PUC Biology Chapter 6 Molecular Basis Of Inheritance

Therefore, percentage of Adenine (A) = 30%.

Question 3.
If the sequence of one strand of DNA is written as follows:
5-ATGCATGCATGCATGCATGCATGCATGC-3
Write down the sequence of complementary strand in 5-3 direction.

Answer:
If the sequence of one strand of DNA is written as follows:
5′–ATGCATGCATGCATGCATGCATGCATGC–3′

Then,
In 3′ → 5′ direction:
3′–TACGTACGTACGTACGTACGTACGTACG–5′

In 5′ → 3′ direction:
5′–GCATGCATGCATGCATGCATGCATGCAT–3′

Question 4.
If the sequence of the coding strand in a transcription unit is written as follows:
5-ATGCATGCATGCATGCATGCATGCATGC-3
Write down the sequence of mRNA.
Answer:
Since mRNA is complementary to the template strand and identical to the coding strand (except thymine (T) is replaced by uracil (U)),

mRNA sequence:
5′-AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3′

Question 5.
Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.
Answer:
The complementary base pairing between the two strands of DNA led Watson and Crick to hypothesize the semi-conservative mode of DNA replication.

They proposed that during replication, the two strands of DNA separate and act as templates for the synthesis of new complementary strands. As a result, each daughter DNA molecule would have one parental (old) strand and one newly synthesized strand.

✅ Hence, this property of complementary base pairing suggested the semi-conservative mode of DNA replication.

Question 6.
Depending upon the chemical nature of the template (DNA or RNA) and the nature of mucleic acids synthesised from it (DNA or RNA). list the types of nucleic acid polymerases.
Answer:
Depending on the chemical nature of the template (DNA or RNA) and the type of nucleic acid synthesized, there are four types of nucleic acid polymerases:

  1. DNA-dependent DNA polymerase – uses DNA as a template to synthesize DNA.
  2. DNA-dependent RNA polymerase – uses DNA as a template to synthesize RNA.
  3. RNA-dependent RNA polymerase – uses RNA as a template to synthesize RNA.
  4. RNA-dependent DNA polymerase (Reverse Transcriptase) – uses RNA as a template to synthesize DNA.

Question 7.
How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
Answer:
A. D. Hershey and Martha Chase conducted an experiment to prove that DNA is the genetic material and not protein. They used T₂ bacteriophages that infect Escherichia coli.

To differentiate between DNA and protein, they used radioactive isotopes:

  • ³²P (phosphorus) to label DNA, because DNA contains phosphorus but no sulfur.
  • ³⁵S (sulfur) to label proteins, because proteins contain sulfur but no phosphorus.

Two separate cultures of E. coli were grown — one in the presence of ³²P and the other in ³⁵S. The bacteriophages grown in these media became labeled with either radioactive DNA or radioactive protein.

When these labeled phages infected fresh E. coli cells:

  • In the case of ³²P-labeled phages, the bacterial cells became radioactive.
  • In the case of ³⁵S-labeled phages, the radioactivity remained in the supernatant.

This showed that DNA, not protein, entered the bacterial cells and was responsible for directing the formation of new phages.

✅ Hence, DNA is the genetic material.

Question 8.
Differentiate between the followings:
(a) Repetitive DNA and Satellite DNA
(b) mRNA and tRNA
(c) Template strand and Coding strand
Answer:

(a)

Repetitive DNA

Satellite DNA

1.

Repetitive DNA consists of sequences that are repeated many times in the genome.

Satellite DNA is a type of repetitive DNA that forms a distinct band (satellite) during density gradient centrifugation.

2.

It includes both coding and non-coding sequences.

It is non-coding and highly repetitive.

3.

It shows normal base composition.

It differs in base composition (A:T or G:C ratio) from bulk DNA.

4.

It does not show distinct peaks during centrifugation.

It forms separate peaks or satellite bands in density gradient centrifugation.

(b)

mRNA (Messenger RNA)

tRNA (Transfer RNA)

1.

mRNA carries genetic information from DNA to ribosomes for protein synthesis.

tRNA carries specific amino acids to the ribosome during translation.

2.

It is linear and varies in length.

It is cloverleaf-shaped due to base pairing within the molecule.

3.

It has codons that determine the sequence of amino acids.

It has anticodons that pair with codons on mRNA.

4.

It is short-lived.

It is stable and reusable.

(c)

Template Strand

Coding Strand

1.

The strand of DNA that acts as a template for RNA synthesis.

The strand whose sequence is identical to the RNA (except T is replaced by U).

2.

It is read in the 3′ → 5′ direction.

It runs in the 5′ → 3′ direction.

3.

It is complementary to both the coding strand and the mRNA.

It has the same nucleotide sequence as mRNA (except T/U difference).

4.

It serves as the actual template for transcription.

It does not take part directly in transcription.

Question 9.
List two essential roles of ribosome during translation.
Answer:
The two essential roles of ribosomes during translation are:

  1. Site for protein synthesis:
    Ribosomes provide a platform where mRNA, tRNA, and amino acids assemble to synthesize proteins.
  2. Catalytic role:
    The rRNA of the larger ribosomal subunit acts as a ribozyme and catalyzes the formation of peptide bonds between amino acids during protein synthesis.

Question 10.
In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?
Answer:
When lactose is added to the medium, it acts as an inducer by binding to the repressor and inactivating it. This allows transcription of the lac operon genes, leading to the production of enzymes required for lactose metabolism.

After some time, as lactose gets completely utilized (broken down) by these enzymes, the level of lactose (inducer) falls. The repressor again becomes active and binds to the operator region, blocking transcription.

Hence, the lac operon shuts down once lactose is consumed.

Question 11.
Explain (in one or two lines) the function of the followings:
(a) Promoter
(b) IRNA
(c) Exons
Answer:
(a) Promoter:

It is the region of DNA where RNA polymerase binds to initiate transcription.

(b) tRNA (Transfer RNA):
It acts as an adapter molecule that carries specific amino acids to the ribosome and pairs its anticodon with the codon on mRNA during translation.

(c) Exons:
Exons are the coding sequences of a gene that express themselves by joining together after splicing to form functional mRNA.

Question 12.
Why is the Human Genome project called a mega project?
Answer:
The Human Genome Project (HGP) is called a mega project because of its huge scale, long duration, and massive data generation. It aimed to determine the complete DNA sequence of the human genome — about 3 × 10⁹ base pairs — and identify all the approximately 20,000–25,000 genes present in humans.

It required large-scale international collaboration, advanced technologies, high computational analysis, and vast financial investment, making it one of the largest biological projects ever undertaken.

Question 13.
What is DNA fingerprinting? Mention its application.
Answer:
DNA fingerprinting is a technique used to identify individuals based on variations in their DNA sequences, particularly in non-coding repetitive sequences called VNTRs (Variable Number of Tandem Repeats).

It works on the principle of polymorphism in DNA sequences.

Applications of DNA Fingerprinting:

  1. Forensic science: Used for identifying criminals from biological samples such as blood, hair, or semen.
  2. Paternity disputes: Helps in determining biological relationships.
  3. Evolutionary and population studies: Used to study genetic diversity and evolutionary relationships among species.
  4. Identification of individuals: Useful in identifying missing persons or disaster victims.

Question 14.
Briefly describe the following:
(a) Transcription
(b) Polymorphism
(c) Translation
(d) Bioinformatics
Answer:
(a) Transcription:

Transcription is the process of synthesising RNA from a DNA template.
In this process, one strand of DNA (template strand) is copied into mRNA by the enzyme RNA polymerase.
It occurs in the nucleus of eukaryotic cells and is the first step of gene expression.

(b) Polymorphism:
Polymorphism refers to the occurrence of variations in DNA sequences among individuals of a population.
These variations arise due to mutation and are inherited, making every individual’s DNA unique.
It forms the basis of DNA fingerprinting and studies on genetic diversity.

(c) Translation:
Translation is the process of protein synthesis from mRNA.
It occurs in the ribosomes, where the sequence of codons on mRNA is read and translated into a specific sequence of amino acids with the help of tRNA and rRNA.

(d) Bioinformatics:
Bioinformatics is the branch of science that deals with the collection, storage, analysis, and interpretation of biological data such as DNA and protein sequences using computers and software tools.
It played a major role in analysing data from the Human Genome Project.

Additional Questions and Answers

Question 1.
Name the scientists who proposed the double helix model of DNA. Write its salient features.
Answer:
Watson and Crick (1953) proposed the double helix model of DNA.
Salient features:

  1. DNA is made up of two complementary strands coiled around each other to form a right-handed double helix.
  2. The two strands are antiparallel – one runs in the 5′ → 3′ direction and the other in the 3′ → 5′ direction.
  3. The bases on the two strands are linked by hydrogen bonds — Adenine pairs with Thymine (A = T) and Guanine with Cytosine (G ≡ C).
  4. Each turn of the helix has about 10 base pairs and measures 4 nm in length.
  5. The sugar-phosphate backbones form the outer framework, while bases lie inside the helix.

Question 2.
What is the function of DNA ligase during DNA replication?
Answer:
DNA ligase joins the Okazaki fragments on the lagging strand by forming phosphodiester bonds, sealing the gaps and forming a continuous DNA strand.

Question 3.
Differentiate between introns and exons.
Answer:

Introns

Exons

Non-coding sequences present in eukaryotic genes.

Coding sequences that determine protein structure.

Removed during RNA splicing.

Joined together after splicing to form functional mRNA.

Not expressed in proteins.

Expressed in the final protein product.

Question 4.
What is a genetic code? Mention its characteristics.
Answer:
A genetic code is the set of rules by which the sequence of bases in mRNA is translated into the sequence of amino acids in a protein.

Characteristics:

  1. It is triplet (three bases code for one amino acid).
  2. It is universal (same in almost all organisms).
  3. It is non-overlapping and comma-less.
  4. It is degenerate (some amino acids are coded by more than one codon).
  5. It has start (AUG) and stop codons (UAA, UAG, UGA).

Question 5.
What is an operon? Describe the lac operon.
Answer:
An operon is a group of genes that are regulated together under one promoter and operator.

Lac operon in E. coli controls the metabolism of lactose. It consists of:

  • Structural genes (lac Z, lac Y, lac A) – code for enzymes β-galactosidase, permease, and transacetylase.
  • Operator – site where the repressor binds.
  • Promoter – site for RNA polymerase binding.
  • Regulator gene – produces the repressor protein.

When lactose is present, it acts as an inducer, inactivating the repressor and allowing transcription of the structural genes.

Question 6.
What is semiconservative replication of DNA? Who proved it?
Answer:
In semiconservative replication, each daughter DNA molecule has one parental strand and one newly synthesized strand.

It was experimentally proved by Meselson and Stahl (1958) using E. coli grown in ¹⁵N and ¹⁴N media.

Question 7.
What are the two types of repetitive DNA sequences found in the human genome?
Answer:

  1. Tandemly repetitive DNA (Satellite DNA) – consists of identical sequences repeated in series.
  2. Interspersed repetitive DNA – sequences scattered throughout the genome.

Question 8.
Mention two enzymes involved in the process of transcription.
Answer:

  1. RNA polymerase – synthesizes RNA from the DNA template.
  2. Ribonuclease P – helps in the processing of tRNA.

Question 9.
Name the enzymes required for the synthesis of a polynucleotide chain.
Answer:
The enzyme DNA polymerase is required for synthesizing a polynucleotide chain during replication by adding nucleotides in the 5′ → 3′ direction.

Question 10.
What are VNTRs? Why are they important in DNA fingerprinting?
Answer:
VNTRs (Variable Number of Tandem Repeats) are short, repetitive DNA sequences present at specific loci in the genome.
They vary in number among individuals, forming the basis of DNA fingerprinting, as no two individuals (except identical twins) have the same VNTR pattern.

You cannot copy content of this page